Infection and cox2 sequence of Pythium chondricola (Oomycetes) causing red rot disease in Pyropia yezoensis (Rhodophyta) in Korea
نویسندگان
چکیده
Copyright © 2017 The Korean Society of Phycology 155 http://e-algae.org pISSN: 1226-2617 eISSN: 2093-0860 Infection and cox2 sequence of Pythium chondricola (Oomycetes) causing red rot disease in Pyropia yezoensis (Rhodophyta) in Korea Soon Jeong Lee, Bo Young Jee, Maeng-Hyun Son and Sang-Rae Lee* Seaweed Research Center, National Institute of Fisheries Science, Mokpo 58746, Korea Aquatic Life Disease Control Division, National Institute of Fisheries Science, Busan 46083, Korea Marine Research Institute, Pusan National University, Busan 46241, Korea
منابع مشابه
Complete Sequence and Analysis of Plastid Genomes of Two Economically Important Red Algae: Pyropia haitanensis and Pyropia yezoensis
BACKGROUND Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics. PRINCI...
متن کاملThe First Symbiont-Free Genome Sequence of Marine Red Alga, Susabi-nori (Pyropia yezoensis)
Nori, a marine red alga, is one of the most profitable mariculture crops in the world. However, the biological properties of this macroalga are poorly understood at the molecular level. In this study, we determined the draft genome sequence of susabi-nori (Pyropia yezoensis) using next-generation sequencing platforms. For sequencing, thalli of P. yezoensis were washed to remove bacteria attache...
متن کاملMorphological and molecular characterization of Oomycetes associated with root and crown rot of cucurbits in Kermanshah province, Iran
Pythium and Phytophthora are among the most well-known plant pathogens around the world that cause rotting of seeds, root, and crown, seedling death, and soft rot of fruits in contact with the soil. In this research, 347 isolates of these two genera and their close genus, Phytopythium were isolated from the cucurbits fields in Kermanshah province, Iran and examined in...
متن کاملOxidative Stress Promotes Asexual Reproduction and Apogamy in the Red Seaweed Pyropia yezoensis
The marine red seaweed Pyropia yezoensis has a haploid-diploid life cycle wherein two heteromorphic generations, a haploid gametophyte and a diploid sporophyte, are reciprocally generated from conchospores and carpospores, respectively. When we treated gametophytic blades of P. yezoensis with H2O2, discharge of asexual monospores was accelerated, resulting in increased numbers of gametophytic c...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کامل